Journal: eLife
Article Title: Tbx5 drives Aldh1a2 expression to regulate a RA-Hedgehog-Wnt gene regulatory network coordinating cardiopulmonary development
doi: 10.7554/elife.69288
Figure Lengend Snippet: Figure 5. FGF8 gain-of-function (GOF) phenocopies Tbx5 loss-of-function in Xenopus. (A) Schematic of FGF8 GOF assay in Xenopus cardiopulmonary foregut (CP-FG) explants dissected at NF20, and treated with vehicle controls (DMSO +0.2% BSA) or the indicated combinations of 100 ng/ml FGF8b and/or 0.5 µM ketoconazole (Cyp-inhibitor), harvested at NF34, and analyzed via RT-qPCR. (B) RT-qPCR showing mean relative expression of genes for pSHF (red), aSHF (blue), and pulmonary endoderm (yellow), ± standard deviation from N=3 biological replicates (four explants/replicate).
Article Snippet: 69288 18 of 29 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Recombinant DNA reagent pRL- TK (plasmid) Promega E2241 Recombinant DNA reagent pGL4.23 luc2/miniP (plasmid) Promega E8411 Recombinant DNA reagent pCS2+ GR- xTbx5 Addgene Addgene 117248 Recombinant DNA reagent pCS2+ xTbx5 Addgene Addgene 117247 Recombinant DNA reagent pCSf107mT- Gateway- 3′myc Addgene Addgene 67617 Recombinant DNA reagent pENTR223 Human TBX5 Horizon Discovery OHS5894- 202500411 Commercial assay or kit Gateway LR Clonase II enzyme mix Thermo Fisher Scientific 11791020 Commercial assay or kit mMessage mMachine SP6 RNA synthesis kit Thermo Fisher Scientific AM1340 Peptide, recombinant protein FGF8b R&D Systems 423- F8- 025 Peptide, recombinant protein WNT2B R&D Systems 3900- WN- 025 Commercial assay or kit TRIzol Thermo Fisher Scientific 15596018 Commercial assay or kit Direct- zol Miniprep plus kit Thermo Fisher Scientific R2070 Commercial assay or kit Superscript VILO mastermix Thermo Fisher Scientific 11755050 Commercial assay or kit PowerUP 2× SYBR Green MasterMix Thermo Fisher Scientific A25742 Commercial assay or kit Firefly Luciferase 2.0 kit Biotium 30085- 1 Commercial assay or kit Renilla Luciferase 2.0 kit Biotium 30082- 1 Chemical compound, drug DEAB Sigma- Aldrich D86256 Chemical compound, drug All- trans retinoic acid (RA) Sigma- Aldrich R2625 Chemical compound, drug Ketoconazole Tocris Tocris#1103 Chemical compound, drug Cycloheximide Sigma- Aldrich C4859 Chemical compound, drug Dexamethasone Sigma- Aldrich Sigma D4902 Peptide, recombinant protein CAS9 PNA Bio CP01- 20 Sequence- based reagent X. tropicalis tbx5 exon5 sgRNA IDT DNA GGGGTTCTGATATGAAGTGA Steimle et al., 2018 Sequence- based reagent X. laevis Tbx5 MO1 GeneTools 5′-TTA GGA AAG TGT CTC TGG TGT TGC C -3′; Brown et al., 2005 Continued Continued on next page Rankin et al. eLife 2021;10:e69288.
Techniques: Quantitative RT-PCR, Expressing, Standard Deviation
R&D Systems is a verified supplier 
R&D Systems manufactures this product 
